Question 1

A biologist who is trying to find open reading frames in a section of DNA is working in the field of

Accepted Answer

A)   functional genomics.
B)   comparative genomics.
C)   metagenomics.
D)   biodiversity.
E)   proteomics.F) B) and D)
G) B) and E)

Question 2

Which statement about the Human Genome Project (HGP) is false?

Accepted Answer

A)   The sequencing of smaller genomes helped in the development of methods that benefited the HGP.
B)   Only privately funded groups were involved in the sequencing effort.
C)   The HGP was in part spurred on by a desire to determine the specific DNA damage caused by radiation from the atomic blasts on Japan during World War II.
D)   One objective of the HGP was to identify genetic changes associated with disease.
E)   It was completed in the first decade of the twenty-first century.F) C) and E)
G) A) and D)

Question 3

The minimal genome for a free-living bacterium that can survive in the laboratory is likely to consist of _______ genes.

Accepted Answer

A)   50 or fewer
B)   about 50 to 100
C)   about 100 to 500
D)   about 500 to 2,000
E)   more than 2,000F) A) and D)
G) B) and E)

Question 4

Which technique,tool,or activity would be most relevant in identifying the genetic variants associated with a complex human disease like schizophrenia?

Accepted Answer

A)   Determination of the metabolome
B)   Selective inactivation
C)   Metagenomics
D)   Haplotype mapping
E)   A pseudogene screenF) C) and D)
G) All of the above

Question 5

DNA sequencing resembles the natural process of

Accepted Answer

A)   protein synthesis.
B)   DNA repair.
C)   DNA replication.
D)   reverse transcription.
E)   alternative splicing.F) C) and E)
G) B) and E)

Question 6

Humans have roughly _______ the number of protein-coding genes as D.melanogaster and about _______ the number of genes as S.cerevisae.

Accepted Answer

A)   twice;twice
B)   twice;four times
C)   four times;four times
D)   four times;100 times
E)   100 times;1,000 timesF) All of the above
G) C) and D)

Question 7

A DNA sequence is cut by two different methods.The first method yields the following fragments (read 5' to 3') : CGATAC;GTCGTCGCC;GTTATCGCGAC.The second method yields the following fragments (read 5' to 3') : CGACGTCGTCGCC;CGATACGTTATCG.What was the original sequence?

Accepted Answer

A)   CGACGTCGTCGCCCGATACGTTATCG
B)   GTCGTCGCCCGATACGTTATCGCGAC
C)   CGATACGTTATCGCGACGTCGTCGCC
D)   CGATACGTCGTCGCCGTTATCGCGAC
E)   CGAUACGUCGUCGCCGUUAUCGCGACF) A) and E)
G) D) and E)

Question 8

You are told that a genome is about 10 Mb long,has 5,000 genes,has introns,and that 65 percent of its sequence is coding sequence.This genome most likely belongs to a(n)

Accepted Answer

A)   virus.
B)   bacterium.
C)   yeast.
D)   multicellular plant.
E)   multicellular animal.F) A) and D)
G) A) and E)

Question 9

Which disease is most unlike the others with respect to its genetic basis?

Accepted Answer

A)   Coronary heart disease
B)   Sickle-cell anemia
C)   Alzheimer's disease
D)   Type I diabetes
E)   Rheumatoid arthritisF) A) and B)
G) D) and E)

Question 10

In high-throughput DNA sequencing technology,the fluorescent dye

Accepted Answer

A)   breaks the DNA into fragments.
B)   produces many identical copies of specific DNA fragments.
C)   labels each of the four nucleotides with a different marker.
D)   enables overlapping sequences to be assembled into one complete sequence.
E)   chemically modifies each nucleotide.F) A) and D)
G) C) and D)

Question 11

Which statement about the nematode C.elegans is false?

Accepted Answer

A)   It has a transparent body.
B)   Despite having a small number of cells,it has a nervous system.
C)   Despite having a small number of cells,it can reproduce sexually.
D)   It normally lives in soil.
E)   All of the above are true;none is false.F) A) and E)
G) A) and B)

Question 12

Which organism would most likely have a proteome that is much larger than the genome?

Accepted Answer

A)   One with a great deal of highly repetitive DNA
B)   One with little highly repetitive DNA
C)   One with a great deal of alternative splicing
D)   One with little alternative splicing
E)   One with a lot of secondary metabolitesF) A) and B)
G) A) and C)

Question 13

A promoter is an example of a(n)

Accepted Answer

A)   open reading frame.
B)   transposable element.
C)   chromatin sequence.
D)   rRNA gene.
E)   regulatory sequence.F) None of the above
G) A) and E)

Question 14

Which statement about the human proteome is false?

Accepted Answer

A)   It is the sum total of all proteins produced by an organism.
B)   It is more complex than the genome.
C)   It includes the small molecules found in a cell.
D)   Its study often involves the use of two-dimensional gel electrophoresis.
E)   All of the above are true;none is false.F) B) and D)
G) A) and B)

Question 15

Which technique or tool is best suited to determine the minimal genome of a free-living bacterium?

Accepted Answer

A)   Metagenomics
B)   Haplotype mapping
C)   Pharmacogenetics
D)   Bacterial artificial chromosomes
E)   Selective inactivation of genesF) B) and E)
G) A) and D)

Question 16

Which statement about DNA fingerprinting is false?

Accepted Answer

A)   Short tandem repeats are the primary genetic unit used in DNA fingerprinting.
B)   DNA fingerprinting can be applied to analyze historical cases as well as current ones.
C)   DNA fingerprinting can be used to determine the identity of the father of a given individual.
D)   PCR is often used in DNA fingerprinting.
E)   All of the above are true;none is false.F) A) and E)
G) C) and E)

Question 17

Which of the following is an example of a secondary metabolite?

Accepted Answer

A)   Tannins produced by oak trees to ward off herbivores
B)   The enzyme phosophofructokinase,which has a role in glycolysis
C)   Hemoglobin carrying oxygen in the blood
D)   Collagen,a structural protein
E)   ATPF) B) and D)
G) D) and E)

Question 18

Short tandem repeats

Accepted Answer

A)   usually are inherited from both the mother and the father.
B)   usually consist of many thousands of repeated units.
C)   are a form of transposon.
D)   are a form of DNA microarray.
E)   consist of open reading frames.F) B) and D)
G) B) and E)

Exam 12: Genomes

Short tandem repeats

Correct Answer
verified

Which statement about DNA fingerprinting is false?

Correct Answer
verified

Which technique or tool is best suited to determine the minimal genome of a free-living bacterium?

Correct Answer
verified

A DNA sequence is cut by two different methods.The first method yields the following fragments (read 5' to 3') : CGATAC;GTCGTCGCC;GTTATCGCGAC.The second method yields the following fragments (read 5' to 3') : CGACGTCGTCGCC;CGATACGTTATCG.What was the original sequence?

Correct Answer
verified

Which organism would most likely have a proteome that is much larger than the genome?

Correct Answer
verified

Which statement about the Human Genome Project (HGP) is false?

Correct Answer
verified

The minimal genome for a free-living bacterium that can survive in the laboratory is likely to consist of _______ genes.

Correct Answer
verified

Which statement about the nematode C.elegans is false?

Correct Answer
verified

Which of the following is an example of a secondary metabolite?

Correct Answer
verified

Which disease is most unlike the others with respect to its genetic basis?

Correct Answer
verified

Which statement about the human proteome is false?

Correct Answer
verified

Humans have roughly _ the number of protein-coding genes as D.melanogaster and about _ the number of genes as S.cerevisae.

Correct Answer
verified

A promoter is an example of a(n)

Correct Answer
verified

Which technique,tool,or activity would be most relevant in identifying the genetic variants associated with a complex human disease like schizophrenia?

Correct Answer
verified

DNA sequencing resembles the natural process of

Correct Answer
verified

A biologist who is trying to find open reading frames in a section of DNA is working in the field of

Correct Answer
verified

You are told that a genome is about 10 Mb long,has 5,000 genes,has introns,and that 65 percent of its sequence is coding sequence.This genome most likely belongs to a(n)

Correct Answer
verified

In high-throughput DNA sequencing technology,the fluorescent dye

Correct Answer
verified

Exam 12: Genomes

Short tandem repeats

Correct AnswerverifiedShow Answer

Which statement about DNA fingerprinting is false?

Correct AnswerverifiedShow Answer

Which technique or tool is best suited to determine the minimal genome of a free-living bacterium?

Correct AnswerverifiedShow Answer

A DNA sequence is cut by two different methods.The first method yields the following fragments (read 5' to 3') : CGATAC;GTCGTCGCC;GTTATCGCGAC.The second method yields the following fragments (read 5' to 3') : CGACGTCGTCGCC;CGATACGTTATCG.What was the original sequence?

Correct AnswerverifiedShow Answer

Which organism would most likely have a proteome that is much larger than the genome?

Correct AnswerverifiedShow Answer

Which statement about the Human Genome Project (HGP) is false?

Correct AnswerverifiedShow Answer

The minimal genome for a free-living bacterium that can survive in the laboratory is likely to consist of _______ genes.

Correct AnswerverifiedShow Answer

Which statement about the nematode C.elegans is false?

Correct AnswerverifiedShow Answer

Which of the following is an example of a secondary metabolite?

Correct AnswerverifiedShow Answer

Which disease is most unlike the others with respect to its genetic basis?

Correct AnswerverifiedShow Answer

Which statement about the human proteome is false?

Correct AnswerverifiedShow Answer

Humans have roughly _______ the number of protein-coding genes as D.melanogaster and about _______ the number of genes as S.cerevisae.

Correct AnswerverifiedShow Answer

A promoter is an example of a(n)

Correct AnswerverifiedShow Answer

Which technique,tool,or activity would be most relevant in identifying the genetic variants associated with a complex human disease like schizophrenia?

Correct AnswerverifiedShow Answer

DNA sequencing resembles the natural process of

Correct AnswerverifiedShow Answer

A biologist who is trying to find open reading frames in a section of DNA is working in the field of

Correct AnswerverifiedShow Answer

You are told that a genome is about 10 Mb long,has 5,000 genes,has introns,and that 65 percent of its sequence is coding sequence.This genome most likely belongs to a(n)

Correct AnswerverifiedShow Answer

In high-throughput DNA sequencing technology,the fluorescent dye

Correct AnswerverifiedShow Answer

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Humans have roughly _ the number of protein-coding genes as D.melanogaster and about _ the number of genes as S.cerevisae.

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified