Question 1

Which techniques, tools, or activities would be most directly useful in identifying the genetic variants associated with a complex human disease such as schizophrenia?

Accepted Answer

A)   Haplotype mapping
B)   Selective inactivation
C)   Metagenomics
D)   Determining the metabolome
E)   Performing a pseudogene screenF) C) and D)
G) B) and E)

Question 2

Refer to the figure showing high-throughput sequencing.  At which step is DNA synthesis halted by the incorporation of a fluorescently tagged nucleoside triphosphate?

Accepted Answer

The answer of Refer to the figure showing high-throughput sequencing....

Question 3

In comparison to Mycoplasma genitalium, the yeast Saccharomyces cerevisiae has

Accepted Answer

A)   a lower chromosome number.
B)   fewer protein-coding genes.
C)   a lower proportion of "essential" genes.
D)   fewer origins of replication.
E)   fewer nucleotides in the genome.F) B) and C)
G) C) and E)

Question 4

Refer to the table showing various sequenced genomes.  Of the nematode, the fruit fly, and the human, which devotes more than one-fifth of its genomes to protein-coding genes?

Accepted Answer

A)   Only the fruit fly
B)   Only the nematode
C)   The nematode and the fruit fly
D)   The nematode and the human
E)   The human and the fruit flyF) None of the above
G) C) and D)

Question 5

Comparisons of yeast and bacterial cell genomes have revealed that

Accepted Answer

A)   yeast cells have more genes devoted to the basic functions of survival than bacteria do.
B)   eukaryotic cells are structurally similar to bacterial cells in terms of complexity.
C)   bacteria and yeast are both haploid.
D)   the histones of bacteria are very similar to those of yeast.
E)   there are more genes for targeting proteins to organelles in yeast than in bacteria.F) A) and E)
G) A) and D)

Question 6

The success or failure of current treatments for hepatitis C is determined to a large extent by genetic variants of the IL28B gene.This important finding is an example of the discoveries coming from the field of _______.

Accepted Answer

The answer of The success or failure of current treatments...

Question 7

Five prokaryote species (labeled A-E)  have been sequenced.Below are the findings of the genes they contain.(Note: "x" denotes the species possessing a functional copy of the gene.)  Gene 1 is essential for the synthesis of several amino acids.Gene 2 encodes a protein involved in strengthening the cell wall.Gene 3 produces an enzyme that breaks down methane.The functions of the other three genes are currently unknown.  Which of these genes is/are likely to be included in the minimal genome?

Accepted Answer

A)   Only genes 1 and 4
B)   Only gene 2
C)   Only gene 5
D)   All of these genes
E)   None of these genesF) C) and D)
G) A) and C)

Question 8

Two transposable elements located near one another (within a few thousand base pairs)  will transpose together and carry the intervening DNA sequence with them.These are known as _______ transposable elements.

Accepted Answer

A)   composite
B)   complementary
C)   associated
D)   additive
E)   interveningF) C) and D)
G) D) and E)

Question 9

Which statement would be considered an expression of genetic determinism?

Accepted Answer

A)   The proteome is more complex than the genome.
B)   The phenotype is a reflection of the genotype.
C)   Studying genes provides a limited understanding of what is going on in the cell.
D)   The metabolome exerts considerable influence on the likelihood of a person's developing diabetes.
E)   High levels of glucose may be an indicator of coronary heart disease.F) A) and B)
G) C) and E)

Question 10

Which statement about prokaryotic transposons is false?

Accepted Answer

A)   They are usually just 1,000 or 2,000 nucleotides long.
B)   They are found in the chromosomal DNA.
C)   They are found in plasmids.
D)   They are found at the same locations in different strains of the same species.
E)   They can be used to infer which genes are essential.F) A) and B)
G) All of the above

Question 11

When eukaryotic genomes and prokaryotic genomes are compared,

Accepted Answer

A)   eukaryotic genomes tend to be smaller than prokaryotic genomes.
B)   eukaryotic genomes tend to have fewer regulatory sequences than prokaryotic genomes.
C)   the percentage of the genome devoted to coding sequences in eukaryotic genomes is lower than in prokaryotic genomes.
D)   eukaryotic genomes have transposons, but prokaryotic genomes do not.
E)   in eukaryotic genomes, there is a single origin of replication on each chromosome.F) A) and E)
G) B) and C)

Question 12

In comparison with prokaryotic genomes, eukaryotic genomes

Accepted Answer

A)   contain less DNA.
B)   have fewer protein-coding genes.
C)   have a lower proportion of protein-coding DNA relative to the overall size.
D)   have fewer regulatory sequences.
E)   have fewer repetitive sequences.F) All of the above
G) C) and D)

Question 13

Suppose a long sequence of DNA is cut with four different restriction enzymes.Which restriction enzyme should produce the fewest fragments?

Accepted Answer

A)   One that cuts at the sequence GACT
B)   One that cuts at the sequence GCCTCT
C)   One that cuts at the sequence AGTTCTAT
D)   One that cuts at the sequence CAGTTCTATG
E)   All of these enzymes would produce roughly the same number of fragments.F) None of the above
G) B) and E)

Question 14

A DNA sequence is cut by two different restriction enzymes (1 and 2) .
Digestion from enzyme 1 yields the following fragments (read in the 5ʹ-to-3ʹ direction) : CGATAC, GTCGTCGCC, and GTTATCGCGAC.Digestion from enzyme 2 yields the following fragments (read in the 5ʹ-to-3ʹ direction) : CGACGTCGTCGCC and CGATACGTTATCG.
What was the original sequence?

Accepted Answer

A)   CGACGTCGTCGCCCGATACGTTATCG
B)   GTCGTCGCCCGATACGTTATCGCGAC
C)   CGATACGTTATCGCGACGTCGTCGCC
D)   CGATACGTCGTCGCCGTTATCGCGAC
E)   GTTATCGCGACGTCGTCGCCCGATACF) A) and D)
G) C) and E)

Question 15

Refer to the table showing several prokaryote (bacterial)  species (labeled A-E)  that have been sequenced, along with the findings of the genes they contain.(Note: "x" marks the species possessing a functional copy of the gene.)  Gene 1 is essential for the synthesis of several amino acids.Gene 2 encodes a protein involved in strengthening the cell wall.Gene 3 produces an enzyme that breaks down methane.The functions of the other five genes are currently unknown.  Which gene is most likely to be part of the prokaryotic minimal genome?

Accepted Answer

A)   Gene 4
B)   Gene 5
C)   Gene 6
D)   Gene 7
E)   Gene 8F) C) and E)
G) C) and D)

Question 16

Caenorhabditis elegans is a roundworm, or nematode, that scientists have used as a model eukaryotic organism in the study of genomics and developmental biology in multicellular organisms.The _______ of its body makes it useful to study cell movement.

Accepted Answer

The answer of Caenorhabditis elegans is a roundworm, or nematode,...

Question 17

In functional genomics, biologists use sequence information to identify the functions of various regions of genomes.Which kinds of information could not be obtained from a genome sequence?

Accepted Answer

A)   Noncoding repetitive repeats
B)   rRNA genes
C)   Genes encoding for transcription factors
D)   Amino acid sequences of proteins
E)   Metabolite levels in cellsF) D) and E)
G) B) and E)

Question 18

Refer to the table showing transposable elements that have been inserted into various genes (labeled A-E) .(Note: "x" indicates the genes that have been knocked out in each experiment, "+" indicates that the bacteria can grow, and "-" indicates that the bacteria cannot grow.)   Which gene is an essential gene?

Accepted Answer

A)   Gene A
B)   Gene B
C)   Gene C
D)   Gene D
E)   Gene EF) None of the above
G) A) and E)

Question 19

Which statement about minimal genomes is true?

Accepted Answer

A)   Mycoplasma genitalium requires the genes for metabolizing both glucose and fructose.
B)   The minimal genome for bacteria contains fewer than 200 genes.
C)   The minimal genome for bacteria contains more than 1,000 genes.
D)   The minimal genome can be inferred through gene knockout experiments.
E)   Genes that are essential for one bacterium under one condition are essential under all conditions.F) A) and D)
G) A) and E)

Question 20

If a plant were to acquire mobility, such that it could more easily escape adverse conditions and enemies, some genes would be lost over evolutionary time.Which function category would most likely lose genes?

Accepted Answer

A)   Photosynthesis
B)   Cell signaling
C)   Plant defense
D)   Cell growth
E)   MetabolismF) C) and D)
G) A) and E)

Exam 17: Genomes

Comparisons of yeast and bacterial cell genomes have revealed that

Correct Answer
verified

Correct Answer
verified

Which techniques, tools, or activities would be most directly useful in identifying the genetic variants associated with a complex human disease such as schizophrenia?

Correct Answer
verified

Which statement about minimal genomes is true?

Correct Answer
verified

Correct Answer
verified

If a plant were to acquire mobility, such that it could more easily escape adverse conditions and enemies, some genes would be lost over evolutionary time.Which function category would most likely lose genes?

Correct Answer
verified

The success or failure of current treatments for hepatitis C is determined to a large extent by genetic variants of the IL28B gene.This important finding is an example of the discoveries coming from the field of _______.

Correct Answer
verified

Caenorhabditis elegans is a roundworm, or nematode, that scientists have used as a model eukaryotic organism in the study of genomics and developmental biology in multicellular organisms.The _______ of its body makes it useful to study cell movement.

Correct Answer
verified

Refer to the table showing various sequenced genomes. Of the nematode, the fruit fly, and the human, which devotes more than one-fifth of its genomes to protein-coding genes?

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Two transposable elements located near one another (within a few thousand base pairs) will transpose together and carry the intervening DNA sequence with them.These are known as _______ transposable elements.

Correct Answer
verified

Which statement would be considered an expression of genetic determinism?

Correct Answer
verified

In comparison to Mycoplasma genitalium, the yeast Saccharomyces cerevisiae has

Correct Answer
verified

In functional genomics, biologists use sequence information to identify the functions of various regions of genomes.Which kinds of information could not be obtained from a genome sequence?

Correct Answer
verified

In comparison with prokaryotic genomes, eukaryotic genomes

Correct Answer
verified

Which statement about prokaryotic transposons is false?

Correct Answer
verified

When eukaryotic genomes and prokaryotic genomes are compared,

Correct Answer
verified

Suppose a long sequence of DNA is cut with four different restriction enzymes.Which restriction enzyme should produce the fewest fragments?

Correct Answer
verified

Refer to the figure showing high-throughput sequencing. At which step is DNA synthesis halted by the incorporation of a fluorescently tagged nucleoside triphosphate?

Correct Answer
verified

Exam 17: Genomes

Comparisons of yeast and bacterial cell genomes have revealed that

Correct AnswerverifiedShow Answer

Correct AnswerverifiedShow Answer

Which techniques, tools, or activities would be most directly useful in identifying the genetic variants associated with a complex human disease such as schizophrenia?

Correct AnswerverifiedShow Answer

Which statement about minimal genomes is true?

Correct AnswerverifiedShow Answer

Correct AnswerverifiedShow Answer

If a plant were to acquire mobility, such that it could more easily escape adverse conditions and enemies, some genes would be lost over evolutionary time.Which function category would most likely lose genes?

Correct AnswerverifiedShow Answer

The success or failure of current treatments for hepatitis C is determined to a large extent by genetic variants of the IL28B gene.This important finding is an example of the discoveries coming from the field of _______.

Correct AnswerverifiedShow Answer

Caenorhabditis elegans is a roundworm, or nematode, that scientists have used as a model eukaryotic organism in the study of genomics and developmental biology in multicellular organisms.The _______ of its body makes it useful to study cell movement.

Correct AnswerverifiedShow Answer

Refer to the table showing various sequenced genomes. Of the nematode, the fruit fly, and the human, which devotes more than one-fifth of its genomes to protein-coding genes?

Correct AnswerverifiedShow Answer

Correct AnswerverifiedShow Answer

Correct AnswerverifiedShow Answer

Two transposable elements located near one another (within a few thousand base pairs) will transpose together and carry the intervening DNA sequence with them.These are known as _______ transposable elements.

Correct AnswerverifiedShow Answer

Which statement would be considered an expression of genetic determinism?

Correct AnswerverifiedShow Answer

In comparison to Mycoplasma genitalium, the yeast Saccharomyces cerevisiae has

Correct AnswerverifiedShow Answer

In functional genomics, biologists use sequence information to identify the functions of various regions of genomes.Which kinds of information could not be obtained from a genome sequence?

Correct AnswerverifiedShow Answer

In comparison with prokaryotic genomes, eukaryotic genomes

Correct AnswerverifiedShow Answer

Which statement about prokaryotic transposons is false?

Correct AnswerverifiedShow Answer

When eukaryotic genomes and prokaryotic genomes are compared,

Correct AnswerverifiedShow Answer

Suppose a long sequence of DNA is cut with four different restriction enzymes.Which restriction enzyme should produce the fewest fragments?

Correct AnswerverifiedShow Answer

Refer to the figure showing high-throughput sequencing. At which step is DNA synthesis halted by the incorporation of a fluorescently tagged nucleoside triphosphate?

Correct AnswerverifiedShow Answer

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified